Diabetes Care
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Song, J.
Right arrow Articles by Lee, H. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Song, J.
Right arrow Articles by Lee, H. K.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
Diabetes Care 24:865-869, 2001
© 2001 by the American Diabetes Association, Inc.


Emerging Treatments and Technologies
Original Article

Peripheral Blood Mitochondrial DNA Content Is Related to Insulin Sensitivity in Offspring of Type 2 Diabetic Patients

Jihyun Song, PhD1, Jee Young Oh, MD2, Yeon-Ah Sung, MD3, Youngmi Kim Pak, PhD1, Kyong Soo Park, MD2 and Hong Kyu Lee, MD2

1 Department of Biomedical Sciences, Korean National Institute Health
2 Department of Internal Medicine and Institute of Endocrinology, Nutrition and Metabolism, Medical Research Center, Seoul National University
3 Department of Internal Medicine, Ewha Womans University College of Medicine, Seoul, Korea


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 CONCLUSIONS
 References
 
OBJECTIVE—To investigate whether the peripheral blood mtDNA (pb-mtDNA) content is decreased and linked to insulin resistance in the offspring of type 2 diabetic patients.

RESEARCH DESIGN AND METHODS—A total of 82 offspring of type 2 diabetic patients and 52 age-, sex-, and BMI-matched normal subjects from the Mokdong, Korea, population were selected for this study by stratified, randomized sampling. Of the offspring of diabetic patients, 52 had normal glucose tolerance (NGT), 21 had impaired glucose tolerance (IGT), and 9 had newly diagnosed type 2 diabetes. The pb-mtDNA content was measured by real-time polymerase chain reaction with a mitochondria-specific fluorescent probe, normalized by a nuclear DNA, 28S rRNA gene. The associations between pb-mtDNA content and several parameters of insulin resistance were studied.

RESULTS—The pb-mtDNA contents tended to be lower in the 82 offspring of type 2 diabetic patients (1,084.7 ± 62.6 vs. 1,304.0 ± 99.2 in the offspring and control subjects, respectively, P = 0.051) and was significantly lower in the combined NGT and IGT offspring group (NGT+IGT, 1,068.0 ± 67.8, P < 0.05) than in the control subjects. In NGT+IGT offspring, the pb-mtDNA content was significantly correlated with logarithmically transformed insulin sensitivity (r = 0.253, P < 0.05) and was the main predictor of insulin sensitivity.

CONCLUSIONS—Quantitative mtDNA status might be a hereditary factor associated with type 2 diabetes and could serve as an indicator for insulin sensitivity.

Abbreviations: AIR, acute insulin response to glucose • FAM, 5-carboxyfluorescein • FSIGT, frequently sampled intravenous glucose tolerance test • IGT, impaired glucose tolerance • NGT, normal glucose tolerance • pb-mtDNA, peripheral blood mtDNA • PCR, polymerase chain reaction • SG, glucose effectiveness • SI, insulin sensitivity index • TAMRA, 6-carboxy-tetramethyl-rhodamine • Tfam, mitochondrial transcriptional factor A


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 CONCLUSIONS
 References
 
The mitochondria are the major site of intracellular respiration and energy metabolism, and their function is intimately related to insulin secretion and possibly insulin action (1,2). Moreover, the mitochondria contain their own genome, with mtDNA coding for some proteins of the respiratory chain. The mutation of mtDNA was believed to cause ~0.5–1% of diabetes (3,4). The content of mtDNA is vital for maintaining the mitochondrial function and the energy demands of the body, but little attention has been paid to the quantitative aspects of mtDNA in diabetes. Several animal and human studies have described variations in mtDNA content. Decreased mtDNA content was found in the pancreatic islets of diabetes-prone Goto-Kakizaki rats (5) and in mitochondrial transcriptional factor A (Tfam)-defective mice (4). Decreased mtDNA content was also found in the skeletal muscle of type 1 and type 2 diabetic patients (6). Although the changes resulting from diabetes might influence the mtDNA content, decreases in peripheral blood mtDNA (pb-mtDNA) were observed before the onset of diabetes (7). Peripheral blood could provide an alternative sample type to skeletal muscle in the diagnosis of mitochondrial pathology because the data on the mitochondrial state in skeletal muscles and peripheral blood lymphocytes were comparable (8). Decreased pb-mtDNA was found to be related to insulin resistance or the development of type 2 diabetes (7).

Although maximum oxygen consumption (VO2max) was positively related to muscle mtDNA and pb-mtDNA content in healthy subjects (9,10), VO2max was negatively related to insulin resistance in healthy first-degree relatives of patients with type 2 diabetes (11). Decreased VO2max mtDNA content and increased insulin resistance are expected in the offspring of diabetic patients. Thus, the purpose of our work was to investigate 1) whether low mtDNA is present in the offspring of the patients with type 2 diabetes and 2) whether low mtDNA is associated with insulin resistance in this population.


    RESEARCH DESIGN AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 CONCLUSIONS
 References
 
Subjects
Subjects were selected by random cluster sampling at Mokdong, which has a population of ~22,000, located in the southwestern part of Seoul (12). We selected 13 of 124 apartment complexes. Of a total 1,804 eligible apartment residents, 750 underwent a 75-g oral glucose tolerance test and were classified as having normal glucose tolerance (NGT), impaired glucose tolerance (IGT), or newly diagnosed diabetes based on the World Health Organization criteria (13). Among the 750 subjects examined, 82 offspring of type 2 diabetic patients as well as 52 age-, sex-, and BMI-matched NGT subjects without a family history of diabetes were selected by questionnaire. Informed consent was obtained from all subjects. The protocol used was approved by the ethics committee of Ewha Women’s University Hospital.

Anthropometric data
In all subjects, blood pressure, height, weight, and waist and hip circumferences were measured. Total body fat content was measured as fat mass (kg) and percent body fat (%) using a bioelectric impedance analyzer. Cross-sectional body fat areas of two sites (subcutaneous abdomen and intra-abdomen) were measured by computed tomography at the umbilical level using an established method (14,15).

Biochemical studies and evaluation for insulin secretion and sensitivity
To determine the insulin sensitivity index (SI), glucose-dependent glucose elimination (glucose effectiveness [SG]), and insulin secretion, the insulin-modified frequently sampled intravenous glucose tolerance test (FSIGT) was used, as described previously (15,16). Glucose (0.3 g glucose/kg body wt) was administered and insulin (0.0125 U/kg body wt) was infused after glucose. SI and SG were calculated using a MINMOD computer program (Version 3.0; University of Southern California, Los Angeles, CA). Acute insulin response to glucose (AIR) was calculated as the mean difference between the insulin level at 2, 3, 4, 5, 6, and 8 min and the basal level. Serum glucose concentrations were determined using the glucose oxidase method. Total cholesterol, triglyceride, and HDL cholesterol levels were determined by enzymatic methods using a Hitachi 7150 autoanalyzer (Hitachi, Tokyo). Nonesterified fatty acid levels were measured by the enzymatic method. Commercial radioimmunoassay kits were used to measure serum insulin, C-peptide (Diagnostic Products, Los Angeles, CA), and serum leptin (Linco Research, St. Charles, MO).

Quantification of mitochondrial DNA using polymerase chain reaction
The total DNA was extracted from peripheral blood leukocytes, and its concentration was measured with a spectrophotometer. The mtDNA content was measured by a real-time polymerase chain reaction (PCR) method using an ABI Prism 7700 (PE Biosystems, CA) as previously described (17). The mtDNA quantity was corrected by simultaneous measurement of the nuclear DNA, 28S rRNA. The mtDNA- and 28S rRNA-specific fluorescent probes were labeled internally using the fluorescent dyes 5-carboxyfluorescein (FAM) on the 5' end, and 6-carboxy-tetramethyl-rhodamine (TAMRA) on the 3' end. The primers for mtDNA were mt2981 (5'ACGACCTCGATGTTGGATC3') and mt3245 (5'GCTCTGCCATCTTAACAAACC3') and were used together with the mtDNA probe (5'FAM-TTCAGACCGGAGTAATCCAGGTCG-TAMRA3' made to nt 3071-3095). The primers of 28S rRNA were 28S-7358 (5'TTAAGGTAGCCAAATGCCTCG3') and 28S-7460 (5'CCTTGGCTGTGGTTTCGCT3') and the 28S rRNA probe was 5'-FAM-TGAACGAGATTCCCACTGTCC-CTACCTACTATC-TAMRA3' made to nt 7408-7440.

The PCR was performed separately for mtDNA and the reference 28S rRNA amplification. The PCR mixture contained the primers (10 pmol each), 200 nmol/l Taqman probe, 200 nmol/l dATP, 200 nmol/l dCTP, 200 nmol/l dGTP, 400 nmol/l dUTP, 4.5 mmol/l MgCl2, 1.25 U AmpliTaqGold polymerase, 0.5 U AmpErase Uracil N-glycosylase, and 1 x PCR buffer A. Amplification was performed under the following conditions: one cycle of 50°C for 2 min, one cycle of 95°C for 10 min, and 40 cycles of 95°C for 15 s and 60°C for 1 min. The amount of starting target in a particular reaction mixture was measured by interpolation from a standard curve of Ct values generated from known concentrations of the standard DNAs.

Statistical analysis
All results are expressed as means ± SEM. Statistical analysis was performed using SPSS software for Windows (SPSS, Chicago, IL). Results of the control subjects and the offspring were analyzed using Students’ t test and analysis of variance. Pearson’s correlation and multiple linear regression analysis were used to evaluate the relationships among mtDNA content and the indexes of insulin secretion and sensitivity and the parameters of insulin resistance syndrome. Results were considered significant when the corresponding P value was <0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 CONCLUSIONS
 References
 
Clinical characteristics of subjects
According to the criteria (13), 52 of the 82 offspring of type 2 diabetic patients had NGT, 21 had IGT, and 9 had newly diagnosed type 2 diabetes. The clinical characteristics of the subjects are shown in Table 1. Age, sex distribution, BMIs, and lipid profiles were not significantly different for the control subjects and the NGT offspring. In diabetic offspring, age, BMI, waist-to-hip ratio, and fasting glucose, fasting insulin, and cholesterol levels were significantly higher than in the control NGT and IGT offspring. Whereas visceral fat areas and visceral-to-subcutaneous fat areas increased, the insulin sensitivity index was significantly lower in diabetic subjects than in the other groups. AIR was significantly lower in NGT and IGT offspring of type 2 diabetic patients than in the control subjects, and it was lowest in the offspring with diabetes (Table 2).


View this table:
[in this window]
[in a new window]
 
Table 1 — Clinical characteristics of subjects

 

View this table:
[in this window]
[in a new window]
 
Table 2 — Patterns of body fat distribution and indexes of insulin secretion and resistance of subjects

 
pb-mtDNA content in control subjects and offspring of diabetic parents
The pb-mtDNA/28S rRNA content was ~17% lower in the offspring of type 2 diabetic subjects (1,084.7 ± 62.6, n = 82) than in the control subjects (1,304.0 ± 99.2, n = 52) at P = 0.051. When the offspring group was divided into three groups, control and NGT subjects were found to have significantly different mtDNA levels (P < 0.05) (Table 1). Interestingly, pb-mtDNA levels tended to increase in those in whom glucose intolerance or diabetes developed. Because the insulin resistance parameters were not significantly different for IGT and NGT offspring, the two groups were combined and compared with the control subjects in terms of mtDNA content; the difference between the control and NGT+IGT subjects was still statistically significant (P < 0.05) (Fig. 1).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 1 — The pb-mtDNA/28S rRNA content in the offspring of type 2 diabetic patients and control subjects. DM, diabetes mellitus. *Significantly different from the control subjects at P < 0.05

 
Relation of mtDNA content to indexes of insulin sensitivity and age
When pb-mtDNA content was plotted against either clinical parameters or indexes of insulin resistance, significant correlations were observed between mtDNA content and either the logarithmically transformed insulin sensitivity index (r = 0.286, P < 0.05) or the fasting C-peptide concentration (r = -0.248, P < 0.05) in all subjects. Correlation between mtDNA content and the visceral fat area showed marginal significance (r = -0.198, P = 0.057). On the other hand, BMI, waist-to-hip ratio, fasting glucose, lipid levels and body fat content, fasting insulin, and AIR did not correlate with pb-mtDNA content. In offspring of type 2 diabetic patients, diastolic blood pressure correlated negatively with mtDNA content (r = -0.209, P = 0.061). Because pb-mtDNA is believed to be influenced by the disease state, data analysis was performed separately on the control subjects and the offspring. The pb-mtDNA content correlated negatively with age (r = -0.316, P < 0.05) in the control subjects, whereas the correlation was blurred in offspring of type 2 diabetic patients.

Pb-mtDNA of the offspring correlated positively with logarithmically transformed insulin sensitivity (r = 0.244, P < 0.05) (Table 3); the linear relationship was maintained in offspring with NGT and IGT (r = 0.253, P < 0.05) (Table 3) but not in offspring with diabetes. Stepwise regression analysis selected visceral fat area and mtDNA content as the main predictors of insulin sensitivity in the combined group of offspring with NGT and IGT (Table 4).


View this table:
[in this window]
[in a new window]
 
Table 3 — Bivariate correlations of mtDNA content with clinical data in subjects

 

View this table:
[in this window]
[in a new window]
 
Table 4 — Stepwise multiple regression analysis for influencing factors of insulin sensitivity

 

    CONCLUSIONS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 CONCLUSIONS
 References
 
This study shows for the first time that pb-mtDNA content is lower in the offspring of type 2 diabetic patients than in age-, sex-, and BMI-matched control subjects without a family history of diabetes. Along with our previous finding that decreased pb-mtDNA content precedes the onset of diabetes (7), the present data support the notion that quantitative decreases of pb-mtDNA are a determinant of type 2 diabetic development. Although pb-mtDNA content shows a tendency of increasing as glucose metabolism deteriorates, this was without statistical significance. The fact that pb-mtDNA content is lower in the offspring of diabetic patients suggests that mtDNA copy number must be inherited. A previous study showed that cord blood mtDNA correlates positively with maternal pb-mtDNA content (18), which also supports the inheritance of mtDNA copy number. Considered together, these findings suggest that there is a heritable factor controlling mtDNA level.

Aging is an another factor known to influence the mtDNA content of tissues (7,19,20,21). Aging is known to be associated with deletions and mutations of mtDNA resulting from the combined effects of intense oxidative damage (20) and the low efficiency of the mtDNA repair system (21). Age-dependent decline of pb-mtDNA was observed in the present study as well as in our previous study (7).

Although mtDNA content is supposed to be related to age and be under genetic control, the mechanisms regarding regulation of mtDNA content are not entirely clear. Tfam is known to play a role in setting the mtDNA status quantitatively (by interacting with mitochondrial single-stranded binding protein and DNA polymerase {gamma}) and in maintaining the normal glucose level (4). Therefore, the quantitative and qualitative aspects of Tfam must be investigated to clarify the mechanism that controls mtDNA content.

The increase of mtDNA content between offspring with NGT and offspring with diabetes is quite interesting because previous studies have reported that the mtDNA content in muscle (6) and peripheral blood (7) of diabetic patients is reduced. It is possible that the low level of mtDNA causes development of diabetes and that they try to compensate for their lack of mtDNA by enhancing mitochondrial biogenesis. We also have unpublished observations that subjects with diabetic complications show atypical increases in mtDNA copy number. Further studies are needed to clarify the regulation of mtDNA content in response to the state and duration of diabetes.

Although the depletion of mtDNA could impair mitochondrial and pancreatic ß-cell function, mitochondrial function can be measured only in the tissues of patients or animals (4,6) and cannot be measured easily in noninvasive samples or in nondiseased subjects. It is believed, therefore, that the pb-mtDNA content could provide an alternative index. An interesting finding of the present study is that the pb-mtDNA content correlates with the insulin sensitivity of the offspring. Fasting serum C-peptide levels correlated negatively with the pb-mtDNA content of the subjects, suggesting that decreased mtDNA content is associated with insulin resistance in offspring. However, mtDNA content did not correlate with either fasting blood glucose or waist-to-hip ratio, and the pb-mtDNA content correlated negatively with diastolic blood pressure, as reported previously in a population-based study (7). The relationship between pb-mtDNA content and the energy utilization pattern of the whole body (22) also suggests that the quantitative status of mtDNA could be an indicator of insulin sensitivity. In summary, we have observed that the pb-mtDNA content decreased in the offspring of type 2 diabetic patients and, furthermore, that the pb-mtDNA content is correlated with insulin sensitivity. These findings suggest that the quantitative mtDNA status might be an early genetic marker for type 2 diabetes and possibly for insulin resistance syndrome.


    ACKNOWLEDGMENTS
 
This study was supported by the Korean National Institute of Health Grant 00-4-5 (to Y.K.P.), a grant from the Good Health 21 Program, Ministry of Health and Welfare Grant HMP-97-M-3-0045 (to Y.S.), and a MOSR/KISTEP grant (to K.S.P. and H.L.)


    FOOTNOTES
 
Address correspondence and reprint requests to Dr. Hong Kyu Lee, Department of Biomedical Sciences, Korean National Institute of Health, Eunpyung-Ku, Nokbun-Dong, #5, Seoul 122-701, Korea. E-mail: hkleemd{at}plaza.snu.ac.kr.

Received for publication 29 August 2000 and accepted in revised form 18 January 2001.

J.S. and J.Y.O. contributed equally to this work.

A table elsewhere in this issue shows conventional and Système International (SI) units and conversion factors for many substances.


    References
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 CONCLUSIONS
 References
 

  1. Gerbitz KD, van den Ouweland JMW, Massen JA, Jaksch M: Mitochondrial diabetes mellitus: a review. Biochim Biophys Acta 1271:253–260, 1995[Medline]
  2. Velho G, Byrne MM, Clement K, Sturis J, Pueyo ME, Blanche H, Vionnet N, Fiet J, Passa P, Robert JJ, Polonsky KS, Froguel P: Clinical phenotypes, insulin secretion, and insulin sensitivity in kindreds with maternally inherited diabetes and deafness due to mitochondrial tRNALeu(UUR) gene mutation. Diabetes 45:478–487, 1996[Abstract]
  3. Kadowaki T, Kadowaki H, Mori Y, Tobe K, Sakuta R, Suzuki Y, Tanabe Y, Sakura H, Awata T, Goto Y: A subtype of diabetes mellitus associated with a mutation of mitochondrial DNA. N Engl J Med 330:962–968, 1994[Abstract/Free Full Text]
  4. Silva JP, Kohler M, Graff C, Oldfors A, Magnuson MA, Berggren PO, Larsson NG: Impaired insulin secretion and ß-cell loss in tissue-specific knockout mice with mitochondrial diabetes. Nat Genet 26:336–340, 2000[Medline]
  5. Serradas P, Giroix MH, Saulnier C, Gangnerau MN, Borg LA, Welsh M, Portha B, Welsh N: Mitochondrial deoxyribonucleic acid content is specially decreased in adult, but not fetal, pancreatic islets of the Goto-Kakizaki rat, a genetic model of noninsulin-dependent diabetes. Endocrinology 136:5623–5631, 1995[Abstract]
  6. Antonetti DA, Reynet C, Kahn CR: Increased expression of mitochondrial encoded genes in skeletal muscles of humans with diabetes mellitus. J Clin Invest 95:1383–1388, 1995
  7. Lee HK, Song JH, Shin CS, Lee HK, Song JH, Shin CS, Park DJ, Park KS, Lee KU, Koh CS: Decreased mitochondrial DNA content in peripheral blood precedes the development of non-insulin-dependent diabetes mellitus. Diabetes Res Clin Pract 42:161–167, 1998[Medline]
  8. Sukhorukov VS, Nartsissov RP, Petrichuk SV, Vasil’ev S, Nikolaeva EA, Kleimenova NV, Klembovskii AI, Kazantseva LZ: Comparative diagnostic value of the analysis of the skeletal muscle and lymphocytes in mitochondrial diseases. Arkh Patol 62:19–21, 2000
  9. Wang H, Hiatt WR, Barstow TJ, Brass EP: Relationship between muscle mitochondrial DNA content, mitochondrial enzyme activity and oxidative capacity in man: alterations with disease. Eur J Appl Physiol 80:22–27, 1999[Medline]
  10. Lim S, Kim SK, Park KS, Kim YS, Cho BY, Yim MJ, Lee HK: The effect of exercise on the mitochondrial DNA content in peripheral blood in healthy women. Eur J Appl Physiol 82:407–412, 2000[Medline]
  11. Nyholm B, Mengel A, Nielsen S, Skjaerbaek C, Moller N, Alberti KG, Schmitz O: Insulin resistance in relatives of NIDDM patients: the role of physical fitness and muscle metabolism. Diabetologia 39:813–822, 1996[Medline]
  12. Breslow NE, Day NE: Statistical methods in cancer research. II. The design and analysis of cohort studies. IARC Sci Publ 82:1–406, 1987
  13. Alberti KG, Zimmet PZ: Definition, diagnosis and classification of diabetes mellitus and its complications. I. Diagnosis and classification of diabetes mellitus: provisional report of a WHO consultation. Diabet Med 15:539–553, 1998[Medline]
  14. Yamashita S, Nakamura T, Shimomura I, Nishida M, Yoshida S, Kotani K, Kameda-Takemuara K, Tokunaga K, Matsuzawa Y: Insulin resistance and body fat distribution. Diabetes Care 19:287–291, 1996[Abstract]
  15. Choi CS, Kim C, Lee WJ, Park JY, Hong SK, Lee MG, Park SW, Lee KU: Association between birth weight and insulin sensitivity in healthy young men in Korea: role of visceral adiposity. Diabetes Res Clin Pract 49:53–59, 2000[Medline]
  16. Bergman RN, Ider YZ, Bowden CR, Cobelli C: Quantitative estimation of insulin sensitivity. Am J Physiol 236:E667–E677, 1979[Abstract/Free Full Text]
  17. Lallemand F, Desire N, Rozenbaum W, Nicolas JC, Marechal V: Quantitative analysis of human herpesvirus 8 viral load using a real-time PCR assay. J Clin Microbiol 38:1404–1408, 2000[Abstract/Free Full Text]
  18. Lee YY, Park DJ, Shin CS, Park KS, Lee HK, Jun CK, Yoon BH, Song JH, Kang BS: Relationship of insulin-like growth factor (IGF)-1, IGF-2, IGF binding protein (IGFBP)-3, and mitochondrial DNA amount in the umbilical cord blood to birth weight. J Korean Diabet Assoc 23:36–45, 1999
  19. Barazzoni R, Short KR, Nair KS: Effects of aging on mitochondrial DNA copy number and cytochrome c oxidase gene expression in rat skeletal muscle, liver, and heart. J Biol Chem 275:3343–3347, 2000[Abstract/Free Full Text]
  20. Sohal RS, Agarwal S, Candas M, Forster MJ, Lal H: Effect of age and caloric restriction on DNA oxidative damage in different tissues of C57BL/6 mice. Mech Ageing Dev 76:215–224, 1994[Medline]
  21. Clayton DA, Doda JN, Friedberg EC: The absence of a pyrimidine dimer repair mechanism in mammalian mitochondria. Proc Natl Acad Sci U S A 71:2777–2781, 1974[Abstract/Free Full Text]
  22. Park KS, Song JH, Lee K-U, Choi CS, Koh JJ, Shin CS, Lee HK: Peripheral blood mitochondrial DNA content correlates with lipid oxidation rate during euglycemic clamps in healthy young men. Diabetes Res Clin Pract 46:149–154, 1999[Medline]

Add to CiteULike CiteULike   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
DiabetesHome page
E. H. Koh, J.-Y. Park, H.-S. Park, M. J. Jeon, J. W. Ryu, M. Kim, S. Y. Kim, M.-S. Kim, S.-W. Kim, I. S. Park, et al.
Essential Role of Mitochondrial Function in Adiponectin Synthesis in Adipocytes
Diabetes, December 1, 2007; 56(12): 2973 - 2981.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. E. Curran, M. P. Johnson, T. D. Dyer, H. H.H. Goring, J. W. Kent, J. C. Charlesworth, A. J. Borg, J. B.M. Jowett, S. A. Cole, J. W. MacCluer, et al.
Genetic determinants of mitochondrial content
Hum. Mol. Genet., June 15, 2007; 16(12): 1504 - 1514.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. Fleischman, S. Johnsen, D. M. Systrom, M. Hrovat, C. T. Farrar, W. Frontera, K. Fitch, B. J. Thomas, M. Torriani, H. C. F. Cote, et al.
Effects of a nucleoside reverse transcriptase inhibitor, stavudine, on glucose disposal and mitochondrial function in muscle of healthy adults
Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1666 - E1673.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
E. Nisoli, E. Clementi, M. O. Carruba, and S. Moncada
Defective Mitochondrial Biogenesis: A Hallmark of the High Cardiovascular Risk in the Metabolic Syndrome?
Circ. Res., March 30, 2007; 100(6): 795 - 806.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
P. D. Taylor and L. Poston
Developmental programming of obesity in mammals
Exp Physiol, March 1, 2007; 92(2): 287 - 298.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
C. J. Jin, H. K. Park, Y. M. Cho, Y. K. Pak, K.-U. Lee, M. S. Kim, S. Friso, S.-W. Choi, K. S. Park, and H. K. Lee
S-Adenosyl-L-Methionine Increases Skeletal Muscle Mitochondrial DNA Density and Whole Body Insulin Sensitivity in OLETF Rats
J. Nutr., February 1, 2007; 137(2): 339 - 344.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S.-H. Ihm, I. Matsumoto, T. Sawada, M. Nakano, H. J. Zhang, J. D. Ansite, D. E.R. Sutherland, and B. J. Hering
Effect of donor age on function of isolated human islets.
Diabetes, May 1, 2006; 55(5): 1361 - 1368.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S.-W. Weng, C.-W. Liou, T.-K. Lin, Y.-H. Wei, C.-F. Lee, H.-L. Eng, S.-D. Chen, R.-T. Liu, J.-F. Chen, I-Y. Chen, et al.
Association of Mitochondrial Deoxyribonucleic Acid 16189 Variant (T->C Transition) with Metabolic Syndrome in Chinese Adults
J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5037 - 5040.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
H. K. LEE, K. S. PARK, Y. M. CHO, Y. Y. LEE, and Y. K. PAK
The role of the mitochondria in human aging and disease: from gene to cell signaling. Proceedings of the second scientific meeting of the Asian Society for Mitochondrial Research and Medicine. April 1-2, 2004. Taipei, Taiwan.
Ann. N.Y. Acad. Sci., May 1, 2005; 1042: 1 - 537.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
P. D. Taylor, J. McConnell, I. Y. Khan, K. Holemans, K. M. Lawrence, H. Asare-Anane, S. J. Persaud, P. M. Jones, L. Petrie, M. A. Hanson, et al.
Impaired glucose homeostasis and mitochondrial abnormalities in offspring of rats fed a fat-rich diet in pregnancy
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2005; 288(1): R134 - R139.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. A Armitage, I. Y Khan, P. D Taylor, P. W Nathanielsz, and L. Poston
Developmental programming of the metabolic syndrome by maternal nutritional imbalance: how strong is the evidence from experimental models in mammals?
J. Physiol., December 1, 2004; 561(2): 355 - 377.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
H. K. LEE
Overview
Ann. N.Y. Acad. Sci., April 1, 2004; 1011(1): 1 - 6.
[Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
H. K. PARK, C. J. JIN, Y. M. CHO, D. J. PARK, C. S. SHIN, K. S. PARK, S. Y. KIM, B. Y. CHO, and H. K. LEE
Changes of Mitochondrial DNA Content in the Male Offspring of Protein-Malnourished Rats
Ann. N.Y. Acad. Sci., April 1, 2004; 1011(1): 205 - 216.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
K. S. Park, S. K. Kim, M. S. Kim, E. Y. Cho, J. H. Lee, K.-U. Lee, Y. K. Pak, and H. K. Lee
Fetal and Early Postnatal Protein Malnutrition Cause Long-Term Changes in Rat Liver and Muscle Mitochondria
J. Nutr., October 1, 2003; 133(10): 3085 - 3090.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. E. Patti, A. J. Butte, S. Crunkhorn, K. Cusi, R. Berria, S. Kashyap, Y. Miyazaki, I. Kohane, M. Costello, R. Saccone, et al.
Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: Potential role of PGC1 and NRF1
PNAS, July 8, 2003; 100(14): 8466 - 8471.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Song, J.
Right arrow Articles by Lee, H. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Song, J.
Right arrow Articles by Lee, H. K.
Social Bookmarking
 Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Diabetes Diabetes Care Clinical Diabetes Diabetes Spectrum