Diabetes Care
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Extract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, J.
Right arrow Articles by Byrne, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, J.
Right arrow Articles by Byrne, C. D.
Social Bookmarking
Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
Diabetes Care 28:2058-2060, 2005
© 2005 by the American Diabetes Association, Inc.

Pathophysiology/Complications
Brief Report

Expression of AdipoR1 In Vivo in Skeletal Muscle Is Independently Associated With Measures of Truncal Obesity in Middle-Aged Caucasian Men

Junlong Zhang, PHD1, Helen Holt, BM, MRCP (U.K.)1, Chunli Wang1, Omar H. Hadid2 and Christopher D. Byrne, PHD, FRCPATH, FRCP1

1 Endocrinology & Metabolism Unit, Developmental Origins of Health and Disease Division, School of Medicine, University of Southampton, Southampton, U.K.
2 Ophthalmology Department, Newcastle upon Tyne Trust, Newcastle upon Tyne, U.K.

Address correspondence and reprint requests to Prof. C.D. Byrne, Endocrinology & Metabolism Unit, Developmental Origins of Health and Disease Division, University of Southampton, Level F, Central Block, Mailpoint 113, Southampton General Hospital, Southampton, SO16 6YD, U.K. E-mail: cdtb{at}soton.ac.uk

Abbreviations: AdipoR, adiponectin receptor • DEXA, dual-energy X-ray absorbtiometry • FFA, free fatty acid • MRI, magnetic resonance imaging


   INTRODUCTION
TOP
 INTRODUCTION
RESEARCH DESIGN AND METHODS
 RESULTS
 CONCLUSIONS
 REFERENCES
 
The insulin-sensitizing effect of adiponectin (1–4) is mediated via adiponectin receptors (AdipoR1 and AdipoR2) (5). AdipoR1 is abundantly expressed in skeletal muscle, whereas AdipoR2 is also expressed in the liver, with lower levels of expression in skeletal muscle (5). Both receptors are expressed in adipose tissue (6) and pancreatic ß-cells (7). It has been shown recently that expression of AdipoRs in human skeletal muscle is correlated with insulin sensitivity (8). Because central obesity is associated with insulin resistance, we have undertaken detailed measurements of body fatness with bioimpedance, dual-energy X-ray absorbtiometry (DEXA), and five-slice magnetic resonance imaging (MRI) through the abdomen. We have determined whether expression of AdipoRs was associated with body fatness and in particular with measures of central obesity.


   RESEARCH DESIGN AND METHODS
TOP
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
RESULTS
 CONCLUSIONS
 REFERENCES
 
The study protocol was undertaken with local research ethics committee approval, and informed consent was obtained from all subjects. Fifteen middle-aged (42–64, mean age 53.2 ± 5.8 years), healthy Caucasian men with a wide range of BMIs (21–39 kg/m2, 30.63 ± 5.48) were recruited. Waist circumference was measured over bare skin midway between the costal margin and the iliac crest. Percentage of body fat was measured using bioelectrical impedance (Bodystat 1500; Bodystat, Isle of Man, U.K.). DEXA scanning was undertaken on a Delphi W instrument (Hologic, Bedford, MA) using a standard visual method to divide images into trunk, limb, and head. Detailed information about visceral fat was obtained from MRI images from five noncontinuous slices extending from 5 cm below to 15 cm above L4-L5 (9). A 3-h hyperinsulinemic-euglycemic clamp was performed with insulin infused at 1.5 mU · kg–1 min–1 and whole blood glucose clamped at 5 mmol/l. The glucose infusion rate in the final steady state was used as a measure of skeletal muscle insulin sensitivity (M value). Fat insulin sensitivity was assessed by percentage free fatty acid (FFA) suppression [FFA (time) – FFA (fast)]/FFA (time) on a 75-g oral glucose tolerance test (3,10–13). Plasma adiponectin and leptin concentrations were analyzed using an ELISA kit (R & D Systems Europe).

Skeletal muscle tissue was obtained before the clamp by Bergstrom needle biopsy of the vastus lateralis muscle in the subjects’ thighs (14), total RNA was prepared from muscle biopsy (15), and RNA concentrations were quantified by spectrophotometry. Primer sequences for quantitative competitive RT-PCR were GACTATTCAGGGATTGCTCT (sense) and CGGAATTCCTGAAGGTTGGA (antisense) for human AdipoR1 (NM_015999) and TCGCCCAAATATCTCCTTTG (sense) and CATCAGCATCAACCAGCCTA (antisense) for AdipoR2 (NM_024551). mRNA levels were quantified using a reproducible and accurate quantitative competitive RT-PCR method (16–18).

Normally distributed data are presented as means ± SD. Skewed data were normalized by logarithmic transformation before Pearson correlation analysis using SPSS software (version 10.1.0; SPSS, Chicago, IL). Correlation was considered to be significant at P < 0.05.


   RESULTS
TOP
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
CONCLUSIONS
 REFERENCES
 
Plasma adiponectin concentrations were negatively correlated with BMI (r = –0.79, P < 0.001), waist circumference (r = –0.80, P < 0.001), and positively correlated with skeletal muscle insulin sensitivity (M values, r = 0.71, P = 0.001), which were consistent with previous findings (2,3,19,20).

mRNA levels of AdipoR1 and -R2 in skeletal muscle were ~0.262 ± 0.135 and ~0.054 ± 0.031 amol/µg total RNA, respectively, and varied markedly between individuals (AdipoR1 0.046–0.63 and AdipoR2 0.0032–0.094 amol/µg total RNA). mRNA concentrations of AdipoR1 were approximately fourfold greater than those of AdipoR2 (P < 0.0001) and were strongly correlated with each other (r = 0.63, P = 0.006). These in vivo data were consistent with data obtained from human myotubes (21).

There was a trend toward significant correlation between mRNA levels of AdipoR1 and muscle insulin sensitivity (M values, r = 0.41; P = 0.063), which were consistent with data obtained from Mexican Americans (8) and animal studies (22). In contrast, mRNA levels of AdipoR1 and -R2 did not correlate with insulin sensitivity in fat assessed by percentage of FFA suppression.

mRNA levels of AdipoR1 were correlated with different measures of body and truncal fat, including waist circumference and truncal fat by DEXA (Table 1). There was a similar trend toward significant correlation between mRNA levels of AdipoR1 and total fat by DEXA or bioimpedance and plasma leptin level (P = 0.086, Table 1), a marker of fat mass (23,24). Plasma leptin levels were strongly correlated with total fat (r = 0.85, P < 0.001) or trunk fat (r = 0.85, P < 0.001) measured on DEXA. In contrast, there was no significant association between mRNA levels of AdipoR1 and lean mass measured by DEXA (r = –0.058, P = 0.42) and MRI visceral fat (P = 0.29, Table 1). No significant correlations between mRNA levels of AdipoR2 and measures of body fat (Table 1) and plasma leptin level were observed (Table 1).


View this table:
[in this window]
[in a new window]
  		Table 1— Subject characteristics

 
mRNA levels of AdipoR2 were correlated with fasting plasma FFA concentrations (r = –0.48, P = 0.036). In contrast, there was no significant correlation between AdipoR1 and age (r = 0.092, P = 0.37), fasting plasma triglycerides (r = –0.043, P = 0.44), cholesterol (r = 0.022, P = 0.47), HDL cholesterol (r = 0.11, P = 0.35), FFA (r = –0.11, P = 0.35), and adiponectin concentrations (r = 0.19, P = 0.25). Similarly, no significant correlations were found between AdipoR2 mRNA levels and age (r = –0.001, P = 0.50), fasting plasma triglycerides (r = –0.075, P = 0.40), cholesterol (r = –0.18, P = 0.27), HDL cholesterol (r = –0.07, P = 0.40), and adiponectin concentrations (r = 0.064, P = 0.41).

Multivariate stepwise linear regression modeling showed that percentage truncal fat by DEXA independently predicted AdipoR1 mRNA levels in a model including M values. Approximately 27.5% (r2 = 0.275, P < 0.05) of the variation in skeletal muscle AdipoR1 could be explained by percentage truncal fat.


   CONCLUSIONS
TOP
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 CONCLUSIONS
REFERENCES
 
Skeletal muscle AdipoR1 expression is independently and inversely correlated with measures of central obesity including waist circumference and truncal fat by DEXA, suggesting a novel mechanism linking skeletal muscle adiponectin signaling, central obesity, and insulin resistance. Further studies are required to determine whether muscle AdipoR1 expression is regulated by insulin or molecules released from adipocytes such as FFA (because fasting FFA concentration is associated with AdipoR2) and adipokines (such as leptin).


   Acknowledgments
 
We are grateful to the Wellcome Trust for grant support, National Health Service Research and Development, and the staff of the Wellcome Trust Clinical Research Facility.


   Footnotes
 
A table elsewhere in this issue shows conventional and Système International (SI) units and conversion factors for many substances.

Received for publication April 1, 2005. Accepted for publication April 29, 2005.


   REFERENCES
TOP
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 CONCLUSIONS
 REFERENCES
 

  1. Yu JG, Javorschi S, Hevener AL, Kruszynska YT, Norman RA, Sinha M, Olefsky JM: The effect of thiazolidinediones on plasma adiponectin levels in normal, obese, and type 2 diabetic subjects. Diabetes 51:2968–2974, 2002[Abstract/Free Full Text]
  2. Stefan N, Vozarova B, Funahashi T, Matsuzawa Y, Weyer C, Lindsay RS, Youngren JF, Havel PJ, Pratley RE, Bogardus C, Tataranni PA: Plasma adiponectin concentration is associated with skeletal muscle insulin receptor tyrosine phosphorylation, and low plasma concentration precedes a decrease in whole-body insulin sensitivity in humans. Diabetes 51:1884–1888, 2002[Abstract/Free Full Text]
  3. Tschritter O, Fritsche A, Thamer C, Haap M, Shirkavand F, Rahe S, Staiger H, Maerker E, Haring H, Stumvoll M: Plasma adiponectin concentrations predict insulin sensitivity of both glucose and lipid metabolism. Diabetes 52:239–243, 2003[Abstract/Free Full Text]
  4. Combs TP, Pajvani UB, Berg AH, Lin Y, Jelicks LA, Laplante M, Nawrocki AR, Rajala MW, Parlow AF, Cheeseboro L, Ding YY, Russell RG, Lindemann D, Hartley A, Baker GR, Obici S, Deshaies Y, Ludgate M, Rossetti L, Scherer PE: A transgenic mouse with a deletion in the collagenous domain of adiponectin displays elevated circulating adiponectin and improved insulin sensitivity. Endocrinology 145:367–383, 2004[Abstract/Free Full Text]
  5. Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T, Miyagishi M, Hara K, Tsunoda M, Murakami K, Ohteki T, Uchida S, Takekawa S, Waki H, Tsuno NH, Shibata Y, Terauchi Y, Froguel P, Tobe K, Koyasu S, Taira K, Kitamura T, Shimizu T, Nagai R, Kadowaki T: Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 423:762–769, 2003[Medline]
  6. Fasshauer M, Klein J, Kralisch S, Klier M, Lossner U, Bluher M, Paschke R: Growth hormone is a positive regulator of adiponectin receptor 2 in 3T3–L1 adipocytes. FEBS Lett 558:27–32, 2004[Medline]
  7. Kharroubi I, Rasschaert J, Eizirik DL, Cnop M: Expression of adiponectin receptors in pancreatic beta cells. Biochem Biophys Res Commun 312:1118–1122, 2003[Medline]
  8. Civitarese AE, Jenkinson CP, Richardson D, Bajaj M, Cusi K, Kashyap S, Berria R, Belfort R, DeFronzo RA, Mandarino LJ, Ravussin E: Adiponectin receptors gene expression and insulin sensitivity in non-diabetic Mexican Americans with or without a family history of type 2 diabetes. Diabetologia 47:816–820, 2004[Medline]
  9. Ross R, Aru J, Freeman J, Hudson R, Janssen I: Abdominal adiposity and insulin resistance in obese men. Am J Physiol Endocrinol Metab 282:E657–E663, 2002[Abstract/Free Full Text]
  10. Byrne CD, Wareham NJ, Mistry PK, Phillips DI, Martensz ND, Halsall D, Talmud PJ, Humphries SE, Hales CN: The association between free fatty acid concentrations and triglyceride-rich lipoproteins in the post-prandial state is altered by a common deletion polymorphism of the apo B signal peptide. Atherosclerosis 127:35–42, 1996[Medline]
  11. Byrne CD, Wareham NJ, Brown DC, Clark PM, Cox LJ, Day NE, Palmer CR, Wang TW, Williams DR, Hales CN: Hypertriglyceridaemia in subjects with normal and abnormal glucose tolerance: relative contributions of insulin secretion, insulin resistance and suppression of plasma non-esterified fatty acids. Diabetologia 37:889–896, 1994[Medline]
  12. Webber J, Whitelaw D, Smith JM, Nattrass M: Glucose and fatty acid metabolism in type 2 diabetes mellitus: an assessment using low-dose insulin infusion and the hyperinsulinaemic euglycaemic clamp. Diabetes Obes Metab 1:173–178, 1999[Medline]
  13. Willi SM, Kennedy A, Wallace P, Ganaway E, Rogers NL, Garvey WT: Troglitazone antagonizes metabolic effects of glucocorticoids in humans: effects on glucose tolerance, insulin sensitivity, suppression of free fatty acids, and leptin. Diabetes 51:2895–2902, 2002[Abstract/Free Full Text]
  14. Zhang J, Phillips DIW, Wang C, Byrne CD: Human skeletal muscle PPAR{alpha} expression correlates with fat metabolism gene expression but not BMI or insulin sensitivity. Am J Physiol Endocrinol Metab 286:E168–E175, 2004[Abstract/Free Full Text]
  15. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159, 1987[Medline]
  16. Zhang J, Desai M, Ozanne SE, Doherty C, Hales CN, Byrne CD: Two variants of quantitative reverse transcriptase PCR used to show differential expression of alpha-, beta- and gamma-fibrinogen genes in rat liver lobes. Biochem J 321:769–775, 1997
  17. Zhang J, Byrne CD: A novel highly reproducible quantitative competitve RT PCR system. J Mol Biol 274:338–352, 1997[Medline]
  18. Zhang J, Day IN, Byrne CD: A novel medium throughput quantitative competitive PCR technology to simultaneously measure mRNA levels from multiple genes. Nuc Acids Res 30:e20, 2002[Abstract/Free Full Text]
  19. Yamamoto Y, Hirose H, Saito I, Tomita M, Taniyama M, Matsubara K, Okazaki Y, Ishii T, Nishikai K, Saruta T: Correlation of the adipocyte-derived protein adiponectin with insulin resistance index and serum high-density lipoprotein-cholesterol, independent of body mass index, in the Japanese population. Clin Sci (Lond) 103:137–142, 2002[Medline]
  20. Matsubara M, Maruoka S, Katayose S: Inverse relationship between plasma adiponectin and leptin concentrations in normal-weight and obese women. Eur J Endocrinol 147:173–180, 2002[Abstract]
  21. Staiger H, Kaltenbach S, Staiger K, Stefan N, Fritsche A, Guirguis A, Peterfi C, Weisser M, Machicao F, Stumvoll M, Haring H-U: Expression of adiponectin receptor mRNA in human skeletal muscle cells is related to in vivo parameters of glucose and lipid metabolism. Diabetes 53:2195–2201, 2004[Abstract/Free Full Text]
  22. Tsuchida A, Yamauchi T, Ito Y, Hada Y, Maki T, Takekawa S, Kamon J, Kobayashi M, Suzuki R, Hara K, Kubota N, Terauchi Y, Froguel P, Nakae J, Kasuga M, Accili D, Tobe K, Ueki K, Nagai R, Kadowaki T: Insulin/foxo1 pathway regulates expression levels of adiponectin receptors and adiponectin sensitivity. J Biol Chem 279:30817–30822, 2004[Abstract/Free Full Text]
  23. Considine RV, Sinha MK, Heiman ML, Kriauciunas A, Stephens TW, Nyce MR, Ohannesian JP, Marco CC, McKee LJ, Bauer TL, Caro JF: Serum immunoreactive-leptin concentrations in normal-weight and obese humans. N Engl J Med 334:292–295, 1996[Abstract/Free Full Text]
  24. Klein S, Fontana L, Young VL, Coggan AR, Kilo C, Patterson BW, Mohammed BS: Absence of an effect of liposuction on insulin action and risk factors for coronary heart disease. N Engl J Med 350:2549–2557, 2004[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Extract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, J.
Right arrow Articles by Byrne, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, J.
Right arrow Articles by Byrne, C. D.
Social Bookmarking
Add to CiteULike   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Diabetes Diabetes Care Clinical Diabetes Diabetes Spectrum